PRACA ORYGINALNA / ORIGINAL ARTICLE

THE ANALYSIS OF ASSOCIATION BETWEEN ENPP1 K121Q POLYMORPHISM AND RISK FACTORS OF TYPE 2 DIABETES MELLITUS IN UKRAINIAN POPULATION

Ирина В. Марченко, Евгений И. Дубовик, Ольга И. Матлай, Антонина А. Беседина, Полина В. Князькова, Елизавета А. Гарбузова

СУМСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ, СУМЫ, УКРАИНА

Irina V. Marchenko, Yevhen I. Dubovyk, Olha I. Matlai, Antonina A. Biesiedina, Polina V. Kniazkova,
Yelizaveta A. Harbuzova

SUMY STATE UNIVERSITY, SUMY, UKRAINE

РЕЗЮМЕ

Вступление: В настоящее время считается, что сахарный диабет 2-го типа (СД-2) возникает у генетически предрасположенных лиц при воздействии ряда факторов внешней среды, провоцирующих клиническое начало заболевания. Одним из генов-кандидатов, имеющих ведущее значение в формировании предрасположенности к СД-2, является ген Ectonucleotide Pyrophosphatase/Phosphodiesterase 1 (ENPP1). Доказана ассоциация его генетического K121Q-полиморфизма с СД-2 в разных популяциях мира.

Цель исследования: Проанализировать ассоциацию K121Q полиморфизма гена ЕNРР1 c факторами риска развития сахарного диабета 2-го типа в украинской популяции.

Материалы и методы: Генотипы пациентов определяли методом полимеразной цепной реакции с последующим анализом длины рестрикционных фрагментов (PCR-RFLP) используя венозною кровь ٣١٧ пациентов с СД-٢ и 302 лиц контрольной группы. Статистический анализ выполнен с помощью программы SPSS-17.0.

Результаты: В результате проведенного генотипирования выявлено, что в группе пациентов с СД-2 соотношение гомозигот по основному аллелю (K/K), гетерозигот (K/Q) и гомозигот по минорному аллелю (Q/Q) составило 188 (59,3%), 108 (34,1%) и 21 (6,6%), а в контроле – 205 (67,9%), 86 (28,5%) и 11 (3,6%) (Р = 0,05). Методом бинарной логистической регрессии установлена достоверная связь в рамках доминантной модели наследования (KQ/QQ vs K/K) (Рн = 0,027). Показано, что у носителей минорного аллеля риск СД-2 в 1,4 (95% CI = 1,043-2,016) раза выше, чем у гомозигот по основному аллелю. После поправки на возраст, пол, привычку курить, ИМТ, ожирение и наличие артериальной гипертензии достоверность этих результатов сохранялась (Рпопр = 0,026).

Выводы: K121Q-полиморфизм гена ENPP1 ассоциирован с развитием сахарного диабета 2-го типа в украинской популяции. У носителей минорного Q-аллеля риск развития СД-2 в 1,4 раза выше, чем у гомозигот по основному К-аллелю. Риск возрастает у пациентов с ИМТ ≥ 25 кг/м2.

 

ABSTRACT

Introduction: More than 100 genes have been described associations between single nucleotide polymorphisms and type 2 diabetes mellitus (T2DM). Among these candidate genes, Ectonucleotide Pyrophosphatase/Phosphodiesterase 1 (ENPP1), is located on the long arm of chromosome 6 (6q23.2) and encodes for a protein which is one of the factors determining the insulin sensitivity. An allelic polymorphism in exon 4 of ENPP1 (rs1044498) has been designated K121Q and widely investigated in T2DM in different populations.

The aim: To analyze the association between ENPP1 K121Q polymorphism with the risk factors of type 2 diabetes mellitus in the Ukrainian population.

Materials and methods: Venous blood of 317 patients with type 2 diabetes mellitus and 302 controls was used for analysis. ENPP1 K121Q genotyping was performed using PCR-RFLP method.

Results: Our results revealed that ratio of K/K homozygotes, K/Q heterozygotes and Q/Q homozygotes between case and control groups was significantly different (59.3%, 34.1%, 6.6% vs 67.9%, 28.5%, 3.6%, P = 0.05). Method of binary logistic regression shown that a reliable relationship was established in the general group for KQ/QQ vs K/K genetic model (P = ٠.٠٢٧). It was shown that in carriers of the minor Q-allele, the risk of T2DM is 1.4x higher than in homozygotes in the main K-allele (95% CI = 1.043-2.016). After adjusting for age, sex, smoking habit, BMI, obesity and the presence of hypertension, the reliability of these results persisted (P = 0.026).

Conclusions: ENPP1 K121Q polymorphism is associated with T2DM in Ukrainian population. In carriers of the minor Q-allele the risk of T2DM is 1.4x higher than in homozygotes in the main K-allele. The risk increases in patients with BMI ≥ 25 kg/m2.

 

Wiad Lek 2018, 71, 4, -820

 

ВВЕДЕНИЕ

В настоящее время сахарный диабет 2-го типа (СД-2) рассматривается как неоднородное по этиологии, патогенезу, клиническому течению, склонностью к развитию и прогрессированию осложнений заболевание. Несмотря на большое количество экспериментальных и клинических исследований, направленных на раскрытие патогенеза сахарного диабета 2-го типа, многие факторы и механизмы развития болезни остаются до конца не изученными. Большая медико-социальная значимость проблемы состоит в том, что СД приводит к ранней инвалидизации и смертности. По данным экспертов ВООЗ, к 2030 году в мире предполагается увеличение числа больных с данной патологией до 552 млн человек, из которых более 90% приходится на сахарный диабет 2-го типа [1].

Раскрытие генетической составляющей СД-2 является одной из основных задач современной медицины. Одним из важных методов, который используется сегодня для выявления наследственной предрасположенности к тем или иным заболеваниям, является анализ однонуклеотидных полиморфизмов (SNP). Ectonucleotide Pyrophosphatase/Phosphodiesterase 1 (ENPP1) – один из генов-кандидатов в риске развития сахарного диабета 2-го типа, расположен в 6(6q22–23q) хромосоме, имеет 25 экзонов и 24 интрона [2]. Наиболее изученным SNP даного гена является полиморфизм 4-го экзона – K121Q (rs1044498), суть которого, заключается в замене азотистого основания аденин на цитозин в 43213 положении гена, что в свою очередь приводит к замене аминокислоты лизин на глутамин в 121 положении белка [3]. Доказана связь K121Q полиморфизма с возникновением СД-2 для представителей многих популяций [4-6].

ЦЕЛЬ ИССЛЕДОВАНИЯ

Целью данного исследования стало изучение ассоциации K121Q-полиморфизма гена ЕNРР1 c развитием сахарного диабета 2-го типа у пациентов с различными факторами риска в украинской популяции.

МАТЕРИАЛЫ И МЕТОДЫ

В исследовании использовали венозную кровь 317 пациентов с сахарным диабетом 2-го типа (51,1% женщин и 48,9% мужчин, средний возраст 64,9 ± 8,2 лет), контрольную группу составили 302 человека (45,7% женщин и 54,3% мужчин, средний возраст 65,1 ± 14,5 лет). Диагностика сахарного диабета у обследованных пациентов проводилась на основании aнaмнестических дaнных, клинических и биохимических методов исследований (клинический анализ крови и мочи, определение глюкозы кpoви, гликемического профиля и гликозилированного гемoглобина) в соответствии с рекомендациями экспертов ВООЗ. В исследование нe включались пaциенты с oстрыми или хроническими воспалительными пpoцессами в стадии обострения, oнкoлогическими и cиcтемными заболеваниями, выражeнной почечной и печеночной нeдoстаточностью, бpoнхиальной aстмой, трaвмой или обширным хирургическим вмешательством, а также лица, которые получали пpeпараты, которые могут пoтeнциально влиять нa уровень глюкозы кpoви.

Работа выполнена в соответствии с принципами Хельсинкской декларации Всемирной медицинской ассоциации «Этические принципы медицинских исследований с участием человека в качестве объекта исследования» и одобрена Комиссией по биоэтике Медицинского института Сумского государственного университета. Перед включением в исследование все участники дали письменное информированное согласие на использование крови в генетических исследованиях.

Для определения генотипов пациентов венозную кровь набирали в стерильных условиях в моноветы объемом 2,7 мл с калиевой солью этилендиаминтетрауксусной кислоты в качестве антикоагулянта («Sarstedt», Германия) и хранили при температуре – 20оС. Выделение геномной ДНК проводили с использованием коммерческого набора «Diatom DNA Prep 100» (ООО «Лаборатория Изоген», Россия).

Участок гена, который содержал K121Q-сайт, амплифицировали с помощью пары специфических праймеров: прямого (forward) 5’CTGTGTTCACTTTGGACATGTTG3’ и обратного (reverse) 5’GACGCTGGAAGATACCAGGCTG3’ («Metabion», Германия). Смесь для амплификации состояла из 50-100 нг ДНК, 5 мкл 5-кратного PCR-буфера, 1,5 ммоль сульфата магния, 150 мкм смеси четырех нуклеотидтрифосфатов, по 15 pM каждого из праймеров и 0,75 ЕД Taq-полимеразы («Thermo Scientific», CША). Объем смеси доводили до 25 мкл деионизированной водой. Полимеразную цепную реакцию (PCR) проводили в термоциклере GeneAmp PCR System 2700 («Applied Biosystems», США). Амплификация состояла из 35 циклов: 1 цикл – 94°С (4 мин), со 2 по 34 цикл – денатурация – 94°С (50 с), гибридизация праймеров – 64,5°С (45 с) и элонгация – 72° С (1 мин), 35 цикл – 72°С (5 мин). Затем 6 мкл продукта амплификации инкубировали при 37° С в течение 18 часов с 5 ЕД рестриктазы Eco47I (AvaII) («Thermo Scientific», CША) в буфере R следующего состава: 10 мМ трис-HCl (pH 8,5), 10 мМ хлорида магния, 100 мМ хлорида калия и 0,1 мг/мл альбумина. Если в 43213-й позиции гена ENPP1 находился цитозин, амплификат, который состоял из 238 пар оснований, расщеплялся рестриктазой Eco47I на два фрагмента – 148 и 90 пар оснований. В случае замены цитозина на аденин сайт рестрикции для Eco47I отсутствовал, и в смеси обнаруживался один фрагмент размером 238 пар оснований (Рис. 1).

Амплификаты изученного фрагмента 4-го экзона гена ENPP1 разделяли в 2,5% агарозном геле, который содержал бромистый этидий. Горизонтальный электрофорез (0,1А; 140V) проводили в течении 30 мин. Визуализацию ДНК после электрофореза осуществляли с помощью трансиллюминатора («Биоком», Россия).

Соответствие распределения генотипов равновесию Харди-Вайнберга проверяли, пользуясь Online Encyclopedia for Genetic Epidemiology Studies (http://www.oege.org/software/hwe-mr-calc.shtml). Основная часть статистического анализа выполнена с использованием программы SPSS-17. Для сравнения распределения генотипов в исследуемой и контрольной группах применяли χ2-критерий Пирсона. Для установления риска развития СД-2 в зависимости от наличия у пациента определенного генотипа с помощью бинарной логистической регрессии рассчитывали отношение шансов (OR) и 95% доверительный интервал (CI) для основных моделей наследования. После этого была использована мультивариабельная логистическая регрессия, которая позволила исследовать ассоциацию генотипов с развитием сахарного диабета 2-го типа в условиях поправки на другие имеющиеся у пациента факторы риска (пол, возраст, ИМТ, артериальная гипертензия и привычка курить). Все тесты были двусторонними, значения Р <0,05 считали статистически значимыми.

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ

Генотипирование пациентов в группах сравнения по K121Q полиморфизму гена ENPP1 позволило установить частоту генотипов и аллелей, с которой они встречаются в украинской популяции (табл. I). В группе пациентов с СД-2 соотношение гомозигот по основному аллелю (K/K), гетерозигот (K/Q) и гомозигот по минорному аллелю (Q/Q) составило 188 (59,3%), 108 (34,1%) и 21 (6,6%), а в контроле 205 (67,9%), 86 (28,5%) и 11 (3,6%) соответственно, что имело статистическую значимость Р = 0,05. Частота основного (K) и минорного (Q) аллелей составила среди больных 76,3% к 23,7% среди здоровых – 82,1% к 17,9%.

Известно, что с развитием сахарного диабета 2-го типа связаны две группы факторов риска. К первой относятся те, которые не модифицируются – это наследственная предрасположенность, возраст, пол, этническая принадлежность, ко второй – те, на которые можно повлиять в процессе жизни, то есть модифицированные: повышенный индекс массы тела, ожирение, курение, сопутствующая артериальная гипертензия (АГ) и др. В таблице II приведены результаты распределения генотипов по K121Q полиморфизму гена ENPP1 среди представителей опытной и контрольной групп после их разделения на когорты, образованные в зависимости от таких факторов риска СД-2 как повышенный ИМТ, ожирение, курение и АГ в анамнезе. Среди лиц с ИМТ ≥ 25 кг/м2 распределение генотипов К/К, K/Q, Q/Q у пациентов с СД-2 составляло – 152 (57,8%), 91 (34,6%), 20 (7,6%), а у лиц без СД-2 – 137 (65,6%), 65 (31,1%),7 (3,3%). Показатель Р, рассчитанный по χ2-критерию Пирсона, равен 0,072 приближался к уровню статистической значимости, однако не пересекал ее. Подобные результаты получены у пациентов с ожирением (Р = 0,078). В подгруппах, образованных по наличию привычки курить и сопутствующей АГ достоверной разницы в частотах генотипов (К/К, K/Q и Q/Q) между пациентами с СД-2 и контролем выявлено не было (Р = 0,426, Р = 0,333 соответственно).

Результаты регрессионного анализа ассоциации генотипов по K121Q полиморфизму гена ENPP1 с развитием СД-2 в рамках разных моделей наследования приведены в табл. III.

Методом бинарной логистической регрессии установлена достоверная связь в рамках доминантной модели наследования (KQ/QQ vs K/K) (Рн = 0,027). Расчет относительного риска в рамках представленной модели показал, что у носителей минорного аллеля риск СД-2 в 1,4 (95% CI = 1,043-2,016) раза выше, чем у гомозигот по основному аллелю. После поправки на возраст, пол, привычку курить, ИМТ, ожирение и наличие артериальной гипертензии достоверность этих результатов сохранялась (Рпопр = 0,026) (ORпопр = 1,455; 95% CI = 1,046-2,024).

Было выяснено, что исследуемый полиморфный сайт не влияет на риск развития сахарного диабета 2-го типа в подгруппах с ИМТ ≥ 25 кг/м2, ожирением, курением, АГ если проводить анализ без учета других факторов риска СД-2 (Р>0,05). Однако, после поправки на другие факторы риска диабета в подгруппе пациентов с ИМТ ≥ 25 кг/м2 анализ в рамках рецессивной модели наследования (Q/Q vs K/K) показал, что у лиц с Q/Q-генотипом риск развития СД-2 возрастает в 1,8 раза (CI = 1,063-3,653; Рпопр = 0,048). Результаты анализа в рамках других моделей не были значимыми.

Полученные нами результаты подтверждают имеющиеся данные об ассоциации K121Q-полиморфизма с риском развития СД-2. Проведенный Tang S et al. мета-анализ, основанный на результатах исследования 40 научных работ в различных популяциях мира, показал, что для общей группы пациентов была установлена достоверная связь между K121Q полиморфизмом гена ENPP1 и СД-2 при сравнении носителей Q-аллеля с K-аллелем (OR = 1,29, 95% CI = 1,16-1,44, P = 0,000) [4]. Учитывая тот факт, что сравнивались пациенты различной этнической принадлежности, данная ассоциация была подтверждена отдельно для пациентов европейского и азиатского происхождения (OR = 1,20, 95% CI = 1,08-1,33 и OR = 1,47, 95% CI = 1,15-1,89, соответственно). Таким образом, Q-аллель может способствовать развитию сахарного диабета 2-го типа у европейцев и азиатов. Для доминантной модели (KQ/QQ vs KK) получены аналогичные результаты (OR = 1,31, 95% CI = 1,16-1,48, P <0,001). При поправке на ковариаты достоверность результатов сохранялась (95% CI = 1,19-1,56, P <0,001). Что касается ассоциации K121Q-полиморфизма гена ENPP1 с развитием СД-2 у пациентов с различной величиной ИМТ, то некоторые авторы получили следующие результаты. Согласно N. Matsuoka et al. K121Q полиморфизм гена ENPP1 не ассоциирован с повышенным ИМТ в европейской и афроамериканской популяциях [7]. Так, распределение генотипов (К/К, К/Q и Q/Q) у европейцев, не страдающих ожирением, составило: 59,2, 36,1 и 4,7%. Среди тех, кто имел ИМТ ≥ 25 кг/м2, частота генотипов была 70,2, 24,6 и 5,2% соответственно (Р = 0,16). В афроамериканской популяции среди тех, кто имел нормальный вес, пациентов с К/К-, К/Q- и Q/Q-генотипами было 5,9, 32,2 и 61,8%; среди тех, кто страдал ожирением, различные варианты генотипов составляли: 9,5, 39,6 и 50,9% соответственно (Р = 0,30). Однако авторы отметили, что у лиц, имевших генотип К/К, ИМТ был выше, чем у носителей минорного Q-аллеля (P < 0,001). В своих исследованиях Hamaguchi K et al. в доминиканской (P > 0,05) [8], Rasmussen SK et al. в датской (P > 0,05) [9], а González-Sánchez JL et al. в испанской популяции (P > 0,05) [10] не установили ассоциации K121Q-полиморфизма гена ENPP1 с ожирением у больных СД-2, но диапазон величины ИМТ в этих исследованиях был между 24 и 28 кг/м2.

Сравнение полученных нами данных при изучении механизмов развития СД-2 в сочетании с АГ и их ассоциация с K121Q-полиморфизмом гена ENPP1 с результатами исследований в других популяциях выявил следующее. J.R. Sowers et al. в своих работах показали, что у больных сахарным диабетом повышение артериального давления встречается значительно чаще, чем в общей популяции [12]. Как было показано ранее в исследовании MRFIT (Multiple Risk Factor Intervention Trial), при одинаковой выраженности различных факторов риска на фоне СД их «вредность» растет в 3-4 раза [11, 13]. D. Zhou et al. в своих работах отметили влияние на развитие СД-2 и АГ таких генов-кандидатов: ESR, KCNJ11, PPARG, TCF7L2, ACE, CAPN 10 и ENPP1 [14]. В проведенных нами исследованиях среди жителей Украины не было обнаружено ассоциации между K121Q полиморфизмом гена ENPP1 и АГ у пациентов с СД-2. Подобные данные получили R.Vasudevan et al. в своих исследованиях на малазийской популяции [16]. В работе S. Bacci et al. при исследовании пациентов Сицилии с инсулинорезистентностью, которые не имели ожирения, установили, что значения АД у лиц с разными генотипами по K121Q полиморфизмом гена ENPP1 достоверно не отличались [15].

В перспективе наших исследований является изучение влияния других известных SNP (rs9375831, rs9402349, rs7769712, IVS20 delT-11 и rs7754561) гена ENPP1 на развитие сахарного диабета 2-го типа у лиц с различными факторами риска в украинской популяции.

ВЫВОДЫ

K121Q-полиморфизм гена ENPP1 ассоциирован с развитием сахарного диабета 2-го типа в украинской популяции. У носителей минорного Q-аллеля риск развития СД-2 в 1,4 раза выше, чем у гомозигот по основному К-аллелю. Риск возрастает у пациентов с ИМТ ≥ 25 кг/м2.

ЛИТЕРАТУРА

1. Zheng Y., Ley S.H., Hu Fr. B. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nature Reviews Endocrinology. 2017;1:1-11.

2. Dong H, Maddux BA, Altomonte J et al. Increased hepatic levels of the insulin receptor inhibitor, PC-1/NPP1, induce insulin resistance and glucose intolerance. Diabetes. 2005;54:367-372.

3. Goldfine ID, Maddux BA, Youngren JF et al. The role of membrane glycoprotein plasma cell antigen 1 ectonucleotide pyrophosphatase phosphodiesterase 1 in the pathogenesis of insulin resistance and related abnormalities. Endocrine Rev. 2008;29:62–75.

4. Tang S.T., Shen X.R., Tang H.Q. et al. Association of the ENPP1 K121Q polymorphism with susceptibility to type 2 diabetes in different populations: evidence based on 40 studies // Endocr. J. 2014;61(11):1093–1103.

5. McAteer J. B., Prudente S., Bacci S. et al. The ENPP1 K121Q polymorphism is associated with type 2 diabetes in European populations // Diabetes. 2008;57:1125–1130.

6. Bochenski J, Placha G, Wanic K et al. New polymorphism of ENPP1 (PC-1) is associated with increased risk of type 2 diabetes among obese individuals. Diabetes. 2006;55(9):2626-2630. doi: 10.2337/db06-0191.

7. Matsuoka N, Patki A, Tiwari HK, et al. Association of K121Q polymorphism in ENPP1 (PC-1) with BMI in Caucasian and African-American adults. International Journal of Obesity. 2006;30:233–237.

8. Hamaguchi K, Terao H, Kusuda Y et al. The PC-1 Q121 allele is exceptionally prevalent in the Dominican Republic and is associated with type 2 diabetes. J Clin Endocrinol Metab. 2004;89:1359–1364.

9. Rasmussen SK, Urhammer SA, Pizzuti A et al. The K121Q variant of the human PC-1 gene is not associated with insulin resistance or type 2 diabetes among Danish Caucasians. Diabetes. 2000;49:1608–1611.

10. González-Sánchez JL, Martínez-Larrad MT, Fernández-Pérez C et al. K121Q PC-1 gene polymorphism is not associated with insulin resistance in a Spanish population. Obes Res. 2003;11:603–605.

11. Stamler J. Stamler R., Neaton J.D. Blood pressure, systolic and diastolic, and cardiovascular risks: US population data. Arch. Intern. Med. 1993;153: 598–615.

12. Sowers J.R. Treatment of hypertension in patients with diabetes. Arch. Intern. Med. 2004;164:1850–1857

13. Whitworth J.A. World Health Organization, International Society of Hypertension Writing Group. 2003 World Health Organization (WHO) / International Society of Hypertension (ISH) statementon management of hypertension. J. Hypertens.2003;21:1983–1992.

14. Zhou D., Ruiter R., Zhang J. et al. Angiotensin-converting enzyme I/D polymorphism is not associated with type 2 diabetes in a Chinese population. J. Renin Angiotensin Aldosterone Syst. 2012;13(3):
372-378.

15. Bacci S., Ludovico O., Prudente S. et al. The K121Q polymorphism of the ENPP1/PC-1 geneis associated with insulin resistance/atherogenic phenotypes, including earlieronset of type 2 diabetes and myocardial infarction. Diabetes.2005;54(10):3021-3025.

16. Vasudevan R., Patimah I., Aisyah A. et al. No association of TCF7L2 and ENPP1 gene polymorphisms in Malaysian type 2 diabetes mellitus with or without hypertension. Research Journal of Biological Sciences. 2009;4(6):703-709.

Представленная работа выполнена в рамках темы научных исследований с госбюджетным финансированием «Молекулярно-генетические и морфологические особенности регенерации тканей нижней конечности в условиях хронической гипергликемии», № гос. регистрации 0117U003926.

Конфликт интересов:

Автора не заявляют о конфликте интересов

АДРЕС ДЛЯ КОРРЕСПОНДЕНЦИИ

Ирина В. Марченко

ул. Санаторная 31, Сумы, Украина

тел. +380506037874

e-mail: i.marchenko@med.sumdu.edu.ua

Прислана: 25.02.2018

Утверждена: 01.06.2018

Рис. 1. Результаты рестрикционного анализа K121Q-полиморфизма гена ENPP1. M – маркер молекулярной массы
(по – пары нуклеиновых оснований) дорожки 3,4,9,10,11 соответствуют К/К-генотипу; 1,2,7,8 – К/Q-генотипу; 5,6 – Q/Q-генотипу.

Таблица I. Распределение аллелей и генотипов по K121Q-полиморфизму гена ENPP1 в группах сравнения

Генотип

СД-2

(n = 317)

Контроль

(n = 302)

PHWE

P

N

%

N

%

K/K

188

59,3

205

67,9

 

0,05

K/Q

108

34,1

86

28,5

Q/Q

21

6,6

11

3,6

Аллель

 

 

   

K

484

76,3

496

82,1

0,611

0,012

Q

150

23,7

108

17,9

Таблица II. Распределение генотипов по K121Q-полиморфизму гена ENPP1 у пациентов с различными факторами риска СД-2

Группа

n

Генотип, n (%)

P

KK

KQ

QQ

ИМТ ≥ 25 кг/м2

СД-2

263

152 (57,8)

91 (34,6)

20 (7,6)

0,072

Контроль

209

137 (65,6)

65 (31,1)

7 (3,3)

Ожирение

СД-2

126

62 (49,2)

47 (37,3)

17 (13,5)

0,078

Контроль

79

49 (62,0)

26 (32,9)

4 (5,1)

Курение

СД-2

76

43 (56,6)

29 (38,2)

4 (5,3)

0,426

Контроль

81

54 (66,7)

24 (29,6)

3 (3,7)

АГ

СД-2

239

141 (59,0)

81 (33,9)

17 (7,1)

0,333

Контроль

145

96 (66,2)

42 (29,0)

7 (4,8)

 

Примечание: n – количество пациентов

Таблица III. Анализ ассоциации генотипов по K121Q-полиморфизму гена ENPP1 с риском СД-2 у пациентов различных подгрупп

Модель

ORc (95 % CI)

Pпопр

ORпопр (95 % CI)

Общая группа

K/Q vs K/K

0,134

1,298 (0,923–1,826)

0,231

1,249 (0,868–1,796)

KQ/QQ vs K/K

0,027

1,450 (1,043–2,016)

0,026

1,455 (1,046–2,024)

Q/Q vs K/K

0,099

1,877 (0,889–3,962)

0,479

1,337 (0,598–2,989)

ИМТ ≥ 25 кг/м2

K/Q vs K/K

0,422

1,172 (0,795–1,727)

0,359

1,214 (0,802–1,839)

KQ/QQ vs K/K

0,086

1,390 (0,954–2,024)

0,146

1,350 (0,901–2,022)

Q/Q vs K/K

0,054

2,375 (0,984–5,730)

0,048

1,802 (1,063–3,653)

Ожирение

K/Q vs K/K

0,523

1,213 (0,671–2,192)

0,366

1,335 (0,713–2,500)

KQ/QQ vs K/K

0,074

1,686 (0,951–2,991)

0,074

1,733 (0,947–3,172)

Q/Q vs K/K

0,062

2,924 (0,946–9,036)

0,129

2,472 (0,769–7,942)

Курение

K/Q vs K/K

0,260

1,465 (0,754–2,848)

0,235

1,559 (0,749–3,242)

KQ/QQ vs K/K

0,195

1,535 (0,803–2,933)

0,273

1,486 (0,732–3,018)

Q/Q vs K/K

0,638

1,444 (0,313–6,676)

0,886

0885 (0,167–4,704)

АГ

K/Q vs K/K

0,316

1,257 (0,803–1,967)

0,437

1,200 (0,758–1,902)

KQ/QQ vs K/K

0,159

1,362 (0,886–2,093)

0,384

1,219 (0,781–1,902)

Q/Q vs K/K

0,373

1,510 (0,610–3,734)

0,807

1,125 (0,437–2,901)

 

Примечание: 95% CI – 95% доверительный интервал; Pн – наблюдаемое значение P (без поправки на ковариаты); ORн – наблюдаемое отношение шансов; Pпопр – значение P после поправки на возраст, пол, индекс массы тела, ожирение, наличие артериальной гипертензии и привычку курить; ORпопр – отношение шансов после поправки на ковариаты.