PRACA ORYGINALNA

ORIGINAL ARTICLE

АСОЦІАЦІЯ Lys198AsnПОЛІМОРФИЗМУ ГЕНА ЕНДОТЕЛІНУ-1 (EDN1) З РОЗВИТКОМ АРТЕРІАЛЬНОЇ ГІПЕРТЕНЗІЇ В УКРАЇНСКІЙ ПОПУЛЯЦІЇ

THE ASSOCIATION OF Lys198Asn -POLYMORPHISM OF ENDOTHELIN-1 GENE (EDN1) WITH DEVELOPMENT OF ARTERIAL HYPERTENSION IN UKRAINIAN POPULATION

Юлія О. Сміянова, Людмила Н. Приступа, Вікторія Ю. Гарбузова, Єлізавета А. Гарбузова

СУМСЬКИЙ ДЕРЖАВНИЙ УНІВЕРСИТЕТ, СУМИ, УКРАЇНА

Ylia O. Smiianova, Ludmyla N. Pristupa, Viktoriia Yu. Harbuzova, Yelizaveta A. Harbuzova

SUMY STATE UNIVERSITY, SUMY, UKRAINE

РЕЗЮМЕ

Вступ: Артеріальна гіпертензія – мультифакторіальне захворювання, яке розвивається під впливом чинників зовнішнього середовище і є генетично детермінованим. Одним із генетичних маркерів, що має провідне значення в розвитку захворювання є ген ендотеліну-1 (EDN1). Сьогодні доведена асоціація поліморфних варіантів цього гена, зокрема Lys198Asn-поліморфізму, з розвитком артеріальної гіпертензії у різних популяціях світу.

Мета: Вивчити асоціацію Lys198Asn-поліморфізму гена ендотеліну-1 з розвитком артеріальної гіпертензії в українській популяції.

Матеріали і методи: Визначення генотипів пацієнтів здійснювали методом полімеразної ланцюгової реакції з наступним аналізом довжини рестрикційних фрагментів (PCR-RFLP) із венозної крові 160 пацієнтів з артеріальною гіпертензією (АГ) та 110 осіб контрольної групи. Статистичний аналіз виконаний за допомогою програми SPSS-17.0.

Результати: У результаті проведеного генотипування показано, що в групі пацієнтів з АГ співвідношення гомозигот за основним алелем (Lys/Lys), гетерозигот (Lys/Asn) і гомозигот за мінорним алелем (Asn/Asn) склало 74 (46,3%), 73 (45,6%), 13 (8,1%), а у контролі – 66 (60,0%), 41 (37,3%), 3 (2,7%) відповідно. Розподіл генотипів у групах порівняння був статистично значущим (χ2= 6,66; Р = 0,036). Методом бінарної логістичної регресії у рамках домінантної та адитивной моделей успадкування був встановлений достовірний зв’язок генотипів за Lys198Asn-поліморфізмом гена EDN1 з розвитком артеріальної гіпертензії (Рн = 0,01). Показано, що носії мінорного алеля (Lys/Asn+Asn/Asn) мають в 1,7 (95 % CI = 1.066 – 2.851), а гомозиготи Asn/Asn – у 3,9 (95 % CI = 1,016 – 9,566) раза більший ризик виникнення артеріальної гіпертензії у порівнянні з особами з Lys/Lys-генотипом. Крім того, пацієнти, що палять з Lys/Asn та Asn/Asn-генотипами мають у 2,6 (95% СІ = 1.224-5.488), а гомозиготи за мінорним алелем (Asn/Asn) у 7,3 (95% СІ = 1.295-41.639) раза вищий ризик настання АГ у порівнянні з гомозиготами Lys/Lys.

Висновки: Lys198Asn-поліморфізм гена ендотеліну-1 асоційований з розвитком артеріальної гіпертензії в українській популяції – носії мінорного алеля (Lys/Asn+Asn/Asn) мають в 1,7, а гомозиготи Asn/Asn мають у 3,9 раза більший ризик виникнення артеріальної гіпертензії, ніж особи з Lys/Lys-генотипом.

КЛЮЧОВІ СЛОВА: артеріальна гіпертензія, поліморфізм генів, ендотелін-1.

ABSTRACT

Introduction: Arterial hypertension is a multifactorial disease developing under the influence of environmental factors and is genetically determined. One of the genetic markers that is of primary importance in the disease development is endothelin-1 gene (EDN1). Today the association between the polymorphic variants of this gene, particularly Lys198Asn-polymorphism, and the development of arterial hypertension in different populations of the world has been proved.

The aim: To study the association between the Lys198Asn-polymorphism of the endothelin-1 gene and the development of arterial hypertension in Ukrainian population.

Materials and methods: The genotypes were determined by the polymerase chain reaction method, followed by the analysis of the restriction fragment length (PCR-RFLP) in venous blood of 160 patients with arterial hypertension and 110 people in the control group. The statistical analysis was performed using SPSS-17.0.

Results: As a result of genotyping, it was found that in the group of patients with arterial hypertension the ratio of homozygote of the major allele (Lys/Lys), heterozygote (Lys/Asn) and homozygote of the minor allele (Asn/Asn) was 74 (46.3%), 73 ( 45.6%), 13 (8.1%), while in control – 66 (60.0%), 41 (37.3%), 3 (2.7%) respectively. The distribution of genotypes in the experimental groups was statistically significant (χ2 = 6.66; P = 0.036). By the method of binary logistic regression within the dominant and additive model of inheritance, a reliable association between the genotype of the Lys198Asn-polymorphism of the ET-1 gene and the development of arterial hypertension was established.

It was shown that carriers of minor allele (Lys/Asn+Asn/Asn) have a risk of arterial hypertension 1.7 (95 % CI = 1.066 – 2.851), and homozygotes Asn/Asn 3.9 (95 % CI = 1.016 – 9.566) times higher than people with Lys/Lys genotype.

In addition, smoking patients with Lys/Asn and Asn/Asn- genotypes have a risk of arterial hypertension 2.6 (95% of SI = 1.224-5.488), and homozygotes of the minor allele (Asn/Asn) 7.3 (95% of SI = 1.295-41.639) times higher than the Lys/Lys homozygotes.

Conclusions: Lys198Asn-polymorphism of the endothelin-1 gene is associated with the development of arterial hypertension in Ukrainian population. Carriers of minor allele (Lys/Asn+Asn/Asn) have a risk of arterial hypertension 1.7, and homozygotes Asn/Asn 3.9 times higher than people with Lys/Lys genotype.

KEY WORDS: arterial hypertension, gene polymorphism, endothelin-1

Wiad Lek 2019, 72, 4, 568-574

ВСТУП

Артеріальна гіпертензія (АГ) є однією з найважливіших проблем сучасної медицині та основним фактором ризику серцево-судинних захворювань (ССЗ) і смерті. АГ діагностується в третини населення планети і щороку призводить до смерті майже 7 млн. людей [1]. Незважаючи на значні досягнення в лікуванні та профілактиці артеріальної гіпертензії, захворюваність на АГ продовжує зростати. Так, чисельність хворих з артеріальною гіпертензією в Україні у 2016 р. сягнула понад 10 млн 421 тис.

На даний час, АГ розглядається як мультифакторіальне захворювання, що виникає під впливом факторів зовнішнього середовища разом із генетично-детермінованими особливостями конституції людини. Важливими чинниками у її розвитку є гіподинамія, надлишкова маса тіла, неправильне харчування, психоемоційне напруження, вік, стать та інші.

Важливою ланкою у розвитку артеріаальної гіпертензії є зміни стану ендотелію кровоносних судин. Серед чинників, що регулюють функціонування ендотелію безумовно одними із найбільш значимих є ендотеліни – біологічно активні пептиди, що впливають на стан системної та регіональної гемодинаміки [2,3]. Найвідоміший серед них – ендотелін-1 (EDN1) – вазоактивний петид, вазоконстрикторна дія якого в 10 разів сильніша за ангіотензин II і в 100 разів перевищує ефект норадреналіну [4].

EDN1, володіючи вазоконстрикторною дією, бере участь в регуляції судинного тонусу, підвищення якого відіграє важливу роль у розвитку і прогресуванні ряду ССЗ. Існують різні механізми, за участю яких EDN1 викликає порушення в судинах, такі як індукція запалення і окисного стресу, збільшення утворення факторів росту (PDGF, FGF, EGF), синтез колагену і позаклітинного матриксу та стимуляція проліферації ГМК [5]. EDN1 також підсилює судинозвужувальні ефекти інших нейрогуморальних і ендокринних чинників. Так, було показано, що EDN1 індукує перетворення ангіотензину I в ангіотензин II [6], сприяючи при цьому розвитку АГ [7]. Так чи інакше, ендотелін-1 сьогодні розглядають як маркер і предиктор важкості та результату ішемічної хвороби серця, зокрема інфаркту міокарда, порушень ритму серця, легеневої і серцевої гіпертензії, атеросклеротичного ушкодження судин та ін. Також вважають, що він причетний до несерцевої патології – післяпологові судинні ускладнення, ураження нирок (гломерулонефрит), ішемічні ураження мозку, цукровий діабет та ін. [8].

Останнім часом показано, що активність функціонування EDN1 залежить від генетичного поліморфізму його гена. Так, Lys198Аsn-поліморфізм багатьма дослідниками розглядається як можливий генетичний маркер розвитку серцево-судинних захворювань [9,10]. Протягом останніх років у публікаціях зарубіжних дослідників активно висвітлюються результати досліджень зв’язку Lys198Asn-поліморфізму гена EDN1 з рівнем ендотеліну в крові та перебігом АГ і серцево-судинних захворювань. Дані літератури досить неоднорідні і суперечливі, що може бути пов’язано з генетичною різноманітністю вибірок, а також різними параметрами порівняння.

МЕТА ДОСЛІДЖЕННЯ

Метою даного дослідження є вивчення асоціації Lys198Asn-поліморфізму гена EDN1 з розвитком артеріальної гіпертензії в українській популяції.

МАТЕРІАЛИ І МЕТОДИ

У дослідженні брали участь 160 пацієнтів із верифікованим діагнозом АГ І, ІІ, ІІІ стадії 1,2,3 ступеня (основна група) та 110 практично здорових осіб (група контролю), що проходили обстеження та лікування на базі КЗ « Сумська міська клінічна лікарня № 1» за період з 2015-2017 рр. Основою діагностики АГ були рекомендації адаптованої клінічної настанови «Артеріальна гіпертензія» (Наказ МОЗ України №384 від 24.05.2012 р.) за результатами детального клініко – інструментального обстеження хворих.

Серед обстежених хворих було 83 жінки (51,9 %) і 77 чоловіка ( 48,1%) у віці 38 – 89 років. У групу контролю увійшло 110 практично здорових осіб , серед них 78 жінок ( 70,9 %) і 32 чоловіків ( 29,1%) у віці 20-82 роки. Усі пацієнти основної групи та групи контролю були обстежені за єдиним планом, що включав наступні етапи: опитування скарг, збір анамнезу, проведення фізикального обстеження пацієнта, вимірювання АТ, антропометричні дослідження, проведення лабораторних досліджень: загальний аналіз крові,біохімічний аналіз крові з визначенням концентрації глюкози та ліпідного спектру, креатиніну; проведення інструментальних досліджень: електрокардіографія (ЕКГ), ехокардіоскопія (ЕхоКС), офтальмоскопія; проведення медико-генетичних досліджень: визначення поліморфізму генів за допомогою полімеразної ланцюгової реакції (ПЛР) з наступним аналізом довжини рестрикаційних фрагментів.

Дослідження проводили з дотриманням основних положень Конвенції Ради Європи про права людини і біомедицини, Гельсінської декларації Всесвітньої медичної асоціації про етнічні принципи проведення наукових медичних досліджень за участі людини і Наказу МОЗ України № 690 від 23.09.2009 р. Всі пацієнти підписали інформовану згоду на участь у дослідженнях із подальшим забором венозної крові на генетичний аналіз.

Венозну кров у хворих на АГ та практично здорових осіб набирали в стерильних умовах у моновети об’ємом 2,7 мл із калієвою сіллю етилендіамінтетраоцтової кислоти (11,7 мМ) в якості антикоагулянту (“Sarstedt”, Німеччина), заморожували та зберігали при температурі -20°С. ДНК виділяли з цільної крові із використанням наборів “ThermoFisher Scientific” (США) згідно протоколу виробника.

Поліморфізм 5-го екзону гена EDN1 (rs 5370) визначали методом полімеразної ланцюгової реакції з наступним аналізом довжини рестрикційних фрагментів за Fleury I. et al. [74] із модифікаціями. Для цього ампліфікували ділянку екзону вказаного гена за допомогою пари специфічних праймерів: прямого (sence) – 5’ TCTTGCTTTATTAGGTCGGAGACC 3’ і зворотного (antisense) – 5’ TTTGAACGAGGACGCTGGTC 3’ (“Metabion” (Німеччина). Для ампліфікації брали 50–100 нг ДНК і додавали до суміші, що містила 5 мкл 5-кратного ПЛР-буферу, 1,5 мМ сульфату магнію, 200 мкМ суміші d-NTP, по 20 pM кожного з праймерів і 1,0 ОД Taq-полімерази (Thermo Scientific, США) , об’єм доводили до 25 мкл деіонізованою водою. ПЛР проводили в термоциклері GeneAmp PCR System 2700 («Applied Biosystems», США). Ампліфікація фрагмента 5-го екзону складалася з 35 циклів: денатурація – 94°С (60 с), гібридизація праймерів – 61,0°С (60 с) і елонгація – 72°С (45 с). Потім 6 мкл продукту ампліфікації інкубували при 37°С протягом 18 годин з 2 ОД рестриктази Сас81 (Thermo Scientific, США) у буфері G такого складу: 10 мМ трис-HCl (pH 7,5), 10 мМ хлориду магнію, 50 мМ NaCl і 0,1 мг/мл альбуміну.

За наявності у 5665-й позиції гена EDN1 гуаніну (G), ампліфікат, розщеплювався рестриктазою на два фрагменти – 189 і 73 п.о. У разі заміни G на тимін сайт рестрикції для Сас81 втрачався. Ампліфікати після рестрикції розділяли в 2,5 % агарозному гелі, що містив 10 мкг/мл бромистого етидію. Горизонтальний електрофорез (0,13А; 160 V) проводили протягом 35 хв. Візуалізацію ДНК після електрофорезу здійснювали за допомогою трансілюмінатора («Біоком», Росія).

Статистичне опрацювання одержаних результатів здійснювали за допомогою програми SPSS-17.0. Відповідність розподілу алелів рівновазі Харді-Вайнберга перевірена за допомогою он-лайн додатку Online Encyclopedia for Genetic Epidemiology studies (http://www.oege.org/software/hwe-mr-calc.shtml).

РЕЗУЛЬТАТИ ТА ОБГОВОРЕННЯ

Частоту дикого (Lys) та мінорного (Asn) алелів, а також розподіл гомозигот за основним алелем (Lys/Lys), гетерозигот (Lys/Asn) та гомозигот за мінорним алелем (Asn/Asn) за Lys198Asn-поліморфизмом гена EDN1 у хворих з артеріальною гіпертензією та представників контрольної групи наведено в табл. I. Показано, що частоти наведених генотипів контрольній групі відповідали рівновазі Харді – Вайнберга (Р > 0,05).

У результаті аналізу даних генотипування встановлено, що співвідношення генотипів Lys/Lys, Lys/Asn та Asn/Asn у групі пацієнтів з артеріальною гіпертензією становило 74 (46,3 %), 73 (45,6 %) і 13 (8,1 %), а у контролі – 66 (60%), 41 (37,3 %), 3 (2,7 %) відповідно. Показник Р, розрахований за χ2-критерієм Пірсона, дорівнював 0,036, що свідчить по існування різниці розподілу поліморфних варіантів гена EDN1 за Lys198Asn-поліморфизмом у хворих на артеріальну гіпертензію та практично здорових осіб.

Результати регресійного аналізу асоціації генотипів за Lys198Asn-поліморфним сайтом гена EDN1 з розвитком артеріальної гіпертензії в рамках домінантної, рецесивної, наддомінантної та адитивної моделей успадкування наведені в табл. II. Статистично значущий зв’язок був встановлений для домінантної (Р = 0,027) та адитивної (Р = 0,041) моделей. Найменшi значення показника критерію Акайке мала адитивна модель (ІКА = 19,29). Таким чином, відповідно до результатів бінарної логістичної регресії в українській популяції носії мінорного алеля (Lys/Asn+Asn/Asn) мають в 1,7 (95 % CI = 1.066 – 2.851), а гомозиготи Asn/Asn – у 3,9 (95 % CI = 1,016 – 9,566) рази більший ризик виникнення артеріальної гіпертензії у порівнянні з особами з Lys/Lys-генотипом.

Наступним етапом аналізу стало вивчення розподілу генотипів за Lys196Asn-поліморфізмом гена END1 у пацієнтів з різними факторами ризику артеріальної гіпертензії, такими як підвищений індекс маси тіла (ІМТ), тютюнопаління та підвищений рівень холестеролу плазми крові (табл. III). Нами виявлено, що серед осіб з підвищеним індексом маси тіла (ІМТ ≥ 25 кг/м2) співвідношення генотипів у групі пацієнтів з АГ та контролі достовірно відрізнялось: 4 (4,7%), 68 (80%), 13 (15,3%) проти 48 (62,3%), 27 (35,1%), 2 (2,6%) (Р <0.001). Подібний висновок отриманий і для осіб, що палять. Розподіл генотипів серед пацієнтів з АГ становив 16 (34,8%), 25(54,3%), 5 (10,9%), тоді як у контрольній групі – 47 (58%), 32(39,5%), 2 (2,5%) (Р = 0,015). Статистично достовірних відмінностей у групах порівняння серед осіб з підвищеним рівнем холестеролу (≥ 5,2ммоль/л) виявлено не було (Р = 0,166). Методом бінарної логістичної регресії встановлено, що серед пацієнтів, що палять, носії Asn-алелю (Lys/Asn та Asn/Asn-генотипи) мають у 2,6 (95% СІ = 1.224-5.488) рази вищий ризик розвитку АГ порівняно з особами, що мають Lys/Lys-генотип відповідно до домінантної моделі успадкування (Р = 0.013). Більш того, за даними адитивної моделі успадкування у цій групі пацієнтів гомозиготи за Asn-алелем (Asn/Asn) мають у 7,3 (95% СІ = 1.295-41.639) рази вищий ризик настання АГ (Р = 0.024) у порівнянні з гомозиготами за Lys-алелем (Lys/Lys) (табл. IV). Результати аналізу асоціації генетичного поліморфізму Lys196Asn гена END-1 з розвитком артеріальної гіпертензії у пацієнетів з гіперхолестеролемією представлені у Таблиці V. Встановлено відсутність статистично значимого зв’язку між алельним поліморфізмом Lys196Asn та настанням АГ серед осіб, що мають підвищений рівень холестеролу крові (Р > 0.05) у даній групі пацієнтів.

Підвищення рівня ендотеліну-1 було доведено у багаточисельних експериментальних і кліничних дослідженнях при серцевій недостатності [11,12], інфаркті міокарду [13], аритміях [14], атеросклерозі [15]. Показано, що при прогресуванні стенокардії одночасно з підвищенням рівня ендотеліну-1 суттєво погіршується ендотелійзалежна вазодилятація судин [16]. Є дані про те, що за умов хронічної артеріальної гіпертензії, що супроводжується порушеннями функцій нирок, підвищується утворення і секреція ендотеліну-1 [17.]

Ген EDN1 локалізований на хромосомі 6р24-р23 і складається з 5 екзонів та чотирьох інтронів [18,19,20]. На сьогодні відомо понад 2 тисячі однонуклеотидних поліморфізмів гена EDN1 (згідно з даними National Center for Biotechnology Information (NCBI)). Доведена асоціація поліморфізмів гена EDN1 з артеріальною гіпертензією [21,22,23], легеневою гіпертензією [24], гострим коронарним синдромом [25,26.], серцевою недостатністю [27], інфарктом міокарда [28], ішемічним інсультом [29]. Одним із клінічно важливих є Lys198Asn-поліморфний сайт. Припускають, що заміна G/T у 5-у екзоні у 5665-й позиції нуклеотидної послідовності, що призводить до заміни амінокислоти лізин (Lys) на аспарагін (Asn) 198 позиції амінокислотної послідовності, змінює білкову структуру і активність ферменту. У наших дослідженнях було доведено, що Lys198Asn-поліморфізм асоційований з розвитком артеріальної гіпертензії в українській популяції. Подібні дослідження проведені іншими вченими для різних популяцій. Так, група вчених T. Rankinen et al. досліджувала вплив Lys198Asn-поліморфізму гена EDN1 на артеріальний тиск залежно від рівня фізичної активності людини. Автори показали, що в осіб із низьким рівнем фізичної активності, які є гомозиготами за мінорним алелем, ризик розвитку АГ більший майже вдвічі (Р = 0,0003), проте такого зв’язку не встановлено у фізично активних і тренованих осіб [30]. У праці V. Adámková et al. підтверджено асоціацію Lys198Asn поліморфного сайта з функцією ендотелію та розвитком артеріальної гіпертензії [31]. За даними Dzholdasbekova A. U., Gaipov A. E. Asn-алель і Asn/Asn-генотип за Lys198Asn-поліморфізмом гена EDN1 є маркером підвищеного ризику розвитку артеріальної гіпертензії [32]. В іншому дослідженні виявлено залежність ризику виникнення підвищеного артеріального тиску та коронарного синдрому від генотипів за Lys198Asn-поліморфним варіантом гена ендотеліну-1 [33]. За результатами досліджень A. U. Joldasbecova у казахській популяції генотип Asn/Asn у 6 разів частіше зустрічався серед пацієнтів з артеріальною гіпертензією, ніж в осіб контрольної групи (Р = 0,012) [34]. Проте, на відміну від інших, група вчених на чолі з S. Wiltshire вивчаючи зв’язок поліморфізму п’ятого екзона гена EDN1 з механізмами розвитку артеріальної гіпертензії, рівнем ліпопротеїдів, метаболічним синдромом і серцево-судинними захворюваннями, не одержали жодних достовірних результатів [35].

ВИСНОВКИ

1. Поліморфізм Lys198Asn гена EDN1 асоційований з розвитком артеріальної гіпертензії в українській популяції.

2. Носії мінорного алеля (Lys/Asn+Asn/Asn) мають в 1,7,а гомозиготи Asn/Asn – у 3,9 раза більший ризик виникнення артеріальної гіпертензії, ніж особи з Lys/Lys-генотипом.

3. Пацієнти, що палять з Lys/Asn та Asn/Asn-генотипами мають у 2,6, а гомозиготи за мінорним алелем (Asn/Asn) у 7,3 раза вищий ризик настання АГ у порівнянні з гомозиготами Lys/Lys.

REFERENCES

1. Bochkareva Yu.V. Effektivnost kombinirovanoy terapii gipertonicheskoy bolezni u patsientov s trevozhno-depresivnyimi rasstroystvami. Aktualnyie voprosy diagnostiki, lecheniya i reabilitatsii bolnyh. Materialy XVII nauchno-prakticheskoy konferentsii s mezhdunarodnyim uchastiem 10 sentyabrya 2014 goda. GBOU DPO PIUV Minzdrava Rossii. 2014;p.30-37

2. Yanagisava M. et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988; 6163(332):411 – 415

3. Timasheva Ya.R., Nasibullin T.R., Imaeva E.B., et al. Polimorfizm genov sistemyi endotelina -1 i risk essentsialnoy gipertenzii.- Meditsinskaya genetika. 2015;10:29- 35

4. Stewart D.J. Increased plasma endothelin-1 in pulmonary hypertension: marker or mediator of disease. Annals of internal medicine. 1991;114:464-469

5. Caprioli J. et al. Polimorphisms of EDNRB, ATG and ACE genes in salt-sensitive hypertension. Canadian journal of physiology and pharmacology. 2008;8(86):505-510

6. Khimji A.K., Rockey D.C. Endothelin-biology and disease. Cell Signal. 2010;22:1615–1625

7. Hynynen M.M., Khalil R.A. The vascular endothelin system in hypertension–recent patents and discoveries. Recent Pat Cardiovasc Drug Discov. 2006;1:95–108

8. Gozmakov O.A. Sistema endotelinovyih peptidov: mehanizmyi endovaskulyarnyih patologiy. Kardiologiya. 2000;1:32-39

9. Berezikova E.N. Kliniko-geneticheskie i neyrogormonalnyie mehanizmyi razvitiya ishemicheskogo remodelirovaniya, apoptoza miokarda i serdechnoy nedostatochnosti: innovatsionnaya strategiya personalizirovannoy diagnostiki, profilaktiki i lecheniya : avtoref. dis. na soiskanie uchenoy stepeni d.med.n. : 14.01.05. Tomsk, 2014;p. 49

10. Jin J.J., Nakura J, Wu Z. et al. Association of Endothelin-1 Gene Variant With Hypertension. Hypertension. 2003;41:163–167

11. Vizir V.A., Berezin A.E. Rol endotelina-1 v progressirovanii serdechnoy nedostatochnosti. Ukr. med. chasopis. 2003:3(35):5-16

12. Munter K, Kirchengast M. The role of endothelin receptor antagonists in cardiovascular pharmacotherapy. Expert. Opin. Emerg. Drugs. 2001;6:3-11

13. Knyazkova I.I., Tsyigankov A.I., Dalashzade S.R. Vliyanie kaptoprila na izmenenie endotelialnyih faktorov u bolnyih s ostryim infarktom miokarda. Ukr. kardIol. zhurn. 2004;7:34-38

14. Luster T.F., Barton M. Endothelins and endothelin receptor antagonists: therapeuttic considerations for a novel class of cardiovascular drugs. Circulation. 2000;102:2434-2440

15. Spinar J., Spinarova L., Vitovec J. et al. Big endothelin and chronic heart failure. Vnitr. Lek. 2002;48:3-7

16. Yip H.K., Wu C.J., Chang H.W. et al. Prognostic value of circulating levels of endothelin-1 in patients after acute myocardial infarction undergoing primary coronary angioplasty. Chest. 2005;127:1491-1497

17. Zateynikov D.A., Minushkina L.O., Kudryashova O.Yu. i dr. Funktsionalnoe sostoyanie endoteliya u bolnyih arterialnoy gipertoniey i ishemicheskoy boleznyu serdtsaю Kardiologiya. 2000;6:14-17

18. Arinami T., Ishikawa M., Inoue A., et al. Chromosomal Assignments of the Human Endothelin Family Genes: the Endothelin-1 Gene (EDN1) to 6p23-P24, the Endothelin-2 Gene (EDN2) to 1p34, and the Endothelin-3 Gene (EDN3) to 20q13.2-Q13.3. Am J Hum Genet. 1991;48:990–969

19. Inoue A., Yanagisawa M., Takuwa Y., et al. The human préproendothéline-1 gene: complete nucleotide sequence and regulation of expression. J. Biol. Chem. 1989;264:14954–14959

20. Kenneth D.B., Friedrich S.P., Lee M.E., et al. Structural Organization and Chromosomal Assignment of the gene encoding endothelin. The journal of biological chemistry. 1989;18(264):10851-10857

21. Fan X.H. et al. The association of an adenine insertion variant in the 5’UTR of the endothelin-1 gene with hypertension and orthostatic hypotension. Arch. Med. Sci. 2012;2(8):219–226

22. Fang Z. et al. Association of endothelin-1 gene polymorphisms with essential hypertension in a Chinese population. Genet. Mol Res. 2017;3(16)

23. Tobe S.W. et al. The impact of endothelin-1 genetic analysis and job strain on ambulatory blood pressure. Journal of Psychosomatic Research. 2011;71:97–101

24. Emad I., Abeer K., Nermin Z. The role of the biomarker and the genetic polymorphism of endothelin-1 in pulmonary arterial hypertension among Egyptians. Egyptian Journal of Chest Diseases and Tuberculosis. 2012;61:495–500

25. Vargas-Alarcon G. et al. The -974C>A (rs3087459) gene polymorphism in the endothelin gene (EDN1) is associated with risk of developing acute coronary syndrome in Mexican patients. Gene. 2014;2(542):258–262

26. Ahmed M., Rghigh A. Polymorphism in Endothelin-1 Gene: An Overview. Curr. Clin. Pharmacol. 2016;3(11):191–210

27. Kitsios G., Zintzaras E. Genetic variation associated with ischemic heart failure: a HuGE review and meta-analysis. Am. J. Epidemiol. 2007;6(166):619– 633

28. Palacín M. et al. Lack of association between endothelin-1 gene variants and myocardial infarction. J. Atheroscler. Thromb. 2009;4(16):388–395

29. Zhang L., Sui R. Effect of SNP Polymorphisms of EDN1, EDNRA, and EDNRB Gene on Ischemic Stroke. Cell. Biochem. Biophys. 2014;70:233–239

30. Rankinen T. et al. Effect of endothelin 1 genotype on blood pressure is dependent on physical activity or fitness levels. Hypertension. 2007;50:1120–1125

31. Minushkina L.O. et al. Angiotensin converting enzyme, NO-synthase, and endothelin-1 genes and left ventricular hypertrophy in natives of Yakutia with hypertensive disease. Kardiologiia. 2005;1(45):41–44

32. Dzholdasbekova A. U., Gaipov A. E. The association between polymorphism of Lys198Asn of endothelin-1 gene and arterial hypertension risk in Kazakh people. Eur. J. Gen. Med. 2010;2(7):187–191

33. Popov A.F. et al. Impact of endothelin-1 Lys198Asn polymorphism on coronary artery disease and endorgan damage in hypertensives. Coronary Artery Disease. 2008;(19): 429–434

34. Joldasbecova A. U. candidate-genes of cardiovascular diseases in Kazakh population. Eur. Asian. Journal of BioMedicine. 2008;1(3)28−30

35. Wiltshire S. et al. Investigating the association between K198N coding polymorphism in EDN1 and hypertension, lipoprotein levels, the metabolic syndrome and cardiovascular disease. Hum Genet. 2008;123:307–313

Представленна работа виконана в рамках теми наукових досліджень з держбюджетним фінансуванням «Молекулярно-генетичні та морфологічні особливості регенерації тканин нижньої кінцівки в умовах хронічної гіперглікемії», № держ. реєстрації 0117U003926.

Вклад авторів:

В порядку черговості авторства.

Конфлікт інтересів:

Автори не заявляють про конфлікт інтересів.

АВТОР ДО КОРЕСПОНДЕНЦІЇ

Юлія О. Сміянова

Сумський державний університет

вул. СКД 10/3, Суми, Україна

тел: +380996098329

e-mail: smijanova@ukr.net

Надіслано: 12.02.2019

Затверджено: 29.03.2019

Таблиця I. Розподіл алелей і генотипів за Lys196Asn поліморфізмом гена END1у групах порівняння

Генотип

АГ

(n = 160)

Контроль

(n = 110)

PHWE

P

n

%

n

%

Lys/Lys

74

46,3

66

60,0

0,036

Lys/Asn

73

45,6

41

37,3

Asn/Asn

13

8,1

3

2,7

Алель

Lys

221

69,1

173

78,6

0.252

0,014

Asn

99

30,9

47

21,4

Примітка: n – кількість пацієнтів. АГ – артеріальна гіпертензія

Таблиця II. Аналіз асоціації поліморфних варіантів Lys196Asn гена END-1 з розвитком артеріальної гіпертензії з урахуванням різних моделей успадкування

Модель успадкування

Р

OR (95% CI)

AIC

Домінантна

0.027

1.743 (1.066-2.851)

19.32

Рецесивна

0.079

3.154 (0.877-11.343)

20.53

Наддомінантна

0.173

1.412 (0.86-2.319)

22.4

Адитивнаa

0.041

3.865 (1.055-14.16)

19.29

0.073

1.588 (0.957-2.635)

Примітка: CI – довірчий інтервал, OR – відношення шансів, AIC – інформаційний критерій Айкайке, а – верхній ряд в адитивній моделі містить результати порівняння між Asn/Asn- і Lys/Lys-генотипами, нижній ряд – між Lys/Asn- і Lys/Lys-генотипами

Таблиця ІІІ. Розподіл генотипів за Lys196Asn-поліморфізмом гена END1 у пацієнтів з різними факторами ризику артеріальної гіпертензії (АГ)

Група

n

Генотип, n (%)

P

Lys/Lys

Lys/Asn

Asn/Asn

ІМТ ≥ ٢٥ кг/м2

АГ

85

4 (4,7%)

68 (80%)

13 (15,3%)

<0.001

Контроль

77

48 (62,3%)

27 (35,1%)

2 (2,6%)

Тютюнопаління

АГ

46

16 (34,8%)

25(54,3%)

5 (10,9%)

0.015

Контроль

81

47 (58%)

32(39,5%)

2 (2,5%)

Холестерин ≥ ٥,٢ммоль/л

АГ

113

33 (29,2%)

67 (59,3%)

13 (11,5%)

0.166

Контроль

26

3 (11,5%)

20 ( 76,9%)

3 (11,5%)

Примітка. n – кількість пацієнтів; ІМТ – індекс маси тіла, ЦД-2 – цукровий діабет 2-го типу

Таблиця IV. Аналіз асоціації поліморфних варіантів Lys196Asn гена END-1 з розвитком артеріальної гіпертензії (АГ) у пацієнетів, що палятьПримітка: CI – довірчий інтервал, OR – відношення шансів, AIC – інформаційний критерій Акайке, а – верхній ряд в адитивній моделі містить результати порівняння між Asn/Asn- і Lys/Lys-генотипами, нижній ряд – між Lys/Asn- і Lys/Lys-генотипами

Модель успадкування

Р

OR (95% CI)

AIC

Домінантна

0.013

2.592 (1.224-5.488)

17.04

Рецесивна

0.067

4.817 (0.895-25.915)

19.66

Наддомінантна

0.108

1.823 (0.877-3.788)

20.85

Адитивнаа

0.024

7.344 (1.295-41.639)

17.01

0.035

2.295 (1.061-4.965)

Рисунок 1. Результати рестрикційного аналізу Lys198Asn-поліморфизму гена EDN1. M – маркер молекулярної маси (по – пари нуклеїнових основ), доріжки 4, 5, 6, 7, 8, 12 відповідають Lys/Lys-генотипу; доріжки 2, 3, 9, 10, 11 – Lys/Asn-генотипу; доріжка 1 – Asn/Asn-генотип.

Таблиця V. Аналіз асоціації поліморфних варіантів Lys196Asn гена END-1 з розвитком артеріальної гіпертензії (АГ) у пацієнетів з гіперхолестеролемією (рівень холестеролу ≥ 5,2 ммоль/л)

Модель успадкування

Р

OR (95% CI)

AIC

Домінантна

0.076

0.316 (0.089-1.126)

14.42

Рецесивна

0.996

0.997 (0.262-3.786)

18.34

Наддомінантна

0.1

0.437 (0.163-1.172)

15.37

Адитивнаа

0.29

0.394 (0.07-2.209)

16.27

0.069

0.305 (0.084-1.099)

Примітка: CI – довірчий інтервал, OR – відношення шансів, AIC – інформаційний критерій Акайке, а – верхній ряд в адитивній моделі містить результати порівняння між Asn/Asn- і Lys/Lys-генотипами, нижній ряд – між Lys/Asn- і Lys/Lys-генотипами

Рисунок 2. Частота генотипів за Lys198Asn-поліморфизмом гена EDN1 серед хворих з артеріальною гіпертензією та контролем.